NJSC Karaganda Medical University
Karaganda, 100000, Kazakhstan
NCT Number: NCT05229822
Despite modern approaches to the diagnosis and treatment of acute bowel obstruction (ABO), postoperative mortality ranges from 5 to 32%, and complications occur up 23% of cases. One of the formidable infectious and inflammatory complications of ABO is sepsis. The main component of the development of sepsis in ABO is bacterial translocation (BT). BT is the migration of intestinal bacteria or their products through the intestinal mucosa into the mesenteric lymph nodes and further into normally sterile tissues and organs.
Today there are several methods for detecting BT:
1. direct method - the detection of 16s rRNA (ribosomal ribonucleic acid) in mesenteric lymph nodes (MLN); 2. indirect method - the detection of serum lipopolysaccharide-binding protein (LBP) and presepsin (Soluble CD14 subtype or sCD14-ST).
The aim of this study is to determine the diagnostic and prognostic significance of bacterial translocation as a predictor of the complications development in patients with malignant and benign acute bowel obstruction by assessing the relationship of biomarkers in the systemic circulation (LBP, sCD14-ST) with the detection of microorganism genes (16s rRNA) in mesenteric lymph nodes.
Looking for future studies?
Notify Me18 year and older
All sexes
Observational
Karaganda, 100000, Kazakhstan
For the early diagnosis of infectious and inflammatory complications, it is necessary to study LBP, sCD-14 and 16sRNA as bacterial translocation markers in patients with malignant and benign acute bowel obstruction, as well as in patients after planned surgical intervention for colon tumors. Based on changes in bacterial translocation biomarkers in the blood serum, it's suggested that patients with researched pathology can be stratified according to the risk level of developing infectious and inflammatory complications.
The study materials are blood serum and mesenteric lymph nodes (MLN). Venous blood sampling will be performed 1 hour before surgery, 24 and 72 hours after it. Venous blood will be collected in 5 ml vacutainers with a coagulation activator and a serum gel separator. It will be centrifuged for 20 minutes at 1000 x g, after which the gel completely separates the serum from the clot, forming a tight barrier.ELISA Kit for Lipopolysaccharide Binding Protein (LBP, Human) and for Presepsin (sCD14-ST, Human), from Cloud-Clone Corp. will be used to determine any presence of LBP and sCD14-ST. The analysis will be performed according to the manufacturer's instructions for an ELISA EVOLIS robotic system from BioRad.
The operating surgeon will perform a MLN sampling in sterile conditions during surgery after resection of the intestine from the mesentery of the gross specimen. MLN will be placed in a sterile tube without any fillers. The DNA will be extracted by the GeneJET Genomic DNA Purification Kit manufactured by Thermo Fisher Scientific, USA, in accordance with the manufacturer's instructions. The 16s rRNA bacteria in MLN will be detected by using real-time PCR and BIO-RAD CFX96 amplifier with 16s rRNA forward and reverse primers (U16SRT-F FACTCCTACGGGAGGGAGGCAGGT and U16SRT-R TATTACCGCGGCTGCTGGGC).
During the implementation, the resources of the Collective Use Laboratory of Research Center Non-profit Joint Stock Company (NJSC) "Karaganda Medical University" will be used.
This research is funded by the Science Committee of the Ministry of Education and Science of the Republic of Kazakhstan (Grant No. AP09260597).
Healthy volunteers accepted: No
Only the study team can determine whether someone qualifies for participation.
Inclusion criteria
Exclusion criteria
Determine any presence of LBP in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.
Determine any presence of sCD14-ST in blood serum by ELISA method 1 hour before surgery, 24 and 72 hours after it.
Determine any presence of 16s rRNA in mesenteric lymph nodes by PCR method.
Time frame: Once (if any complication occurs during hospitalization - from 7 to 28 days)
Аny infectious and inflammatory complications in post-operative period (wound suppuration, anastomotic leak, аbdominal abscesses, peritonitis, sepsis, etc.)
Time frame: 1 hour before surgery, 72 hours after surgery
LBP levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.
Time frame: 1 hour before surgery, 72 hours after surgery
sCD14-ST levels will be compared between groups/ subgroups and in each group/subgroup in dynamic.
Time frame: Once (MLN sampling in sterile conditions during surgery)
Presence or absence of 16s rRNA in mesenteric lymph nodes will be compared between groups/subgroups.
Karaganda Medical University
Other
Prognostic Significance of Bacterial Translocation Markers as Predictors of Infectious and Inflammatory Complications in Acute Mechanical Bowel Obstruction
OpenTrials presents study information sourced from ClinicalTrials.gov. The official registry record should be consulted for the latest information.
View the official ClinicalTrials.gov record (opens in a new tab)This listing is for discovery and informational purposes only. It is not medical advice, does not guarantee that a study is recruiting, and does not determine eligibility. Contact the study team and a qualified healthcare professional when considering participation.
Published trials that share one or more normalized conditions with this study.
NCT00758186
Colonic Diseases, Colorectal Cancer
Singapore
View Trial DetailsNCT07705139
Bowel Sounds, Colonic Diseases
Wuhan, Hubei, China
View Trial DetailsNCT07650461
Digestive System Diseases, Emergency Laparotomy
Muzaffargarh, Punjab Province, Pakistan
View Trial DetailsNCT07258017
Digestive System Diseases, Gastrointestinal Diseases
Changsha, Hunan, China
View Trial Details