Telomere Length in Relation to Acute Stress Response in Critical Care Patients

Telomeres length analysis were determined from 2 blood samples, the initial sample drawn in the first 72 hours after hospitalization and the second after not < 5 or > 14 days. For patients discharged before day 5, a repeat sample was drawn and analyzed on the discharge day. The blood sample processing was as follows: 5 ml of blood was collected and the red blood cells (RBC) were lysed using the RBC lysis solution (Biological Industries, Beit Haemek, Israel). Isolation of genomic DNA was performed by using the DNA isolation kit for mammalian blood (Roche, Mannheim, Germany). Briefly, DNA was isolated by the salting out procedure, washed and precipitated by isopropanol. The DNA was resuspended in polymerase chain reaction (PCR) grade water. The DNA concentration was measured by using the NanoDrop device (Thermo Fisher, USA).

DNA samples were analyzed for telomere length according to the method of Cawthon (2009) [20] with slight modifications. Each DNA sample was analyzed by two sets of primers detailed below, one for telomere length analysis and one for a reference gene analysis (human hemoglobin). The primers were diluted to 100µM in PCR grade water and then to 10µM. DNA samples were diluted to 2.5 ng/µl in PCR grade water. The primers sequences are shown below:

telc: TGTTAGGTATCCCTATCCCTATCCCTATCCCTATCCCTAACA telg: ACACTAAGGTTTGGGTTTGGGTTTGGGTTTGGGTTAGTGT hbgd:_GCCCGGCCCGCCGCGCCCGTCCCGCCGGAGGAGAAGTCTGCCGTT hbgu: GGCGGCGGGCGGCGCGGGCTGGGCGGCTTCATCCACGTTCACCTTG

Reaction PCR were processed as follows:

50°C for 2 min, 95°C for 5 min, a single cycle of 94°C for 15 sec, 49°C for 15 sec; 40 cycles of: 94°C for 15sec, 62°C for 10 sec and a final stage of: 74°C for 15 sec. All reactions were performed using the Step One device (ABI, USA).

Inclusion criteria

• • Patients hospitalized up to 72 hours prior to admission to the ICU

• Predicted ICU stay is at least 5 days

Exclusion criteria

• • Pregnancy and lactation