Skip to main content
OpenTrials
Completed

NCT Number: NCT05269901

Association Between Ferroptosis and Epilepsy

Epilepsy is one of the most common neurologic disorders seen in children, often characterized by recurring seizures. Nearly 10.5 million children worldwide are estimated to have active epilepsy. Children with epilepsy are more likely to have developmental health and developmental comorbidities such as depression, anxiety, attention deficit hyperactivity disorder, learning disabilities, and developmental delay compared to children without epilepsy. Status epilepticus (SE) is the most common life-threatening emergency neurological emergency in children and leads to hippocampal neuronal cell death. The animal model proved SE-induced neuronal cell death in hippocampal CA1 and CA3 regions. Classical drugs like carbamazepine or phenytoin often cause behavioral problems and side effects such as unsteady gait, depression, and irritability. In addition, classical medicine did not protect cognitive function and preferred to drive drug-resistant. Therefore, it is necessary to develop a novel therapy to treat epilepsy. Ferroptosis is a new type of cell death, usually accompanied by a large amount of iron accumulation and lipid peroxidation. It is widely accepted that glutamate-mediated neuronal hyperexcitation plays a causative role in eliciting seizures, and cystine/glutamate antiporter inhibition induces ferroptosis. Hence, investigators hypothesize GPX4 dependent ferroptosis pathway may play a key role in eliciting seizures.

Completed

Looking for future studies?

Notify Me

Key information

Conditions

Epilepsy Brain Diseases Central Nervous System Diseases Nervous System Diseases

Age range

6 year–12 year

Sex eligibility

All sexes

Study type

Observational

Primary location

Affiliated Hospital of JiangNan University, Department of Pediatrics

Wuxi, Jiangsu, 226600, China

About this study

To investigate the possible association between GPX4 dependent ferroptosis pathway and epilepsy. Investigators first obtained gene expression of GSE25453 from GEO (https://www.ncbi.nlm.nih.gov/geo), which contained ten medial temporal lobe epilepsy and ten adjacent non-seizure region tissues. Then, investigators further the possible association between GPX4 dependent ferroptosis pathway and epilepsy in school-aged children. Investigators obtained peripheral blood from 20 newly diagnosed untreated school-aged children (6 -12 years) and 20 age-matched healthy controls. Three glutathione peroxidase 4 (GPX4）dependent ferroptosis pathway biomarkers were investigated: Solute Carrier Family 7 Member 11（SLC7A11), GPX4, tumor protein 53 (P53). Western blot and Rt-qPCR were used to investigate the possible changes in these three biomarkers.

Who can participate

Healthy volunteers accepted: Yes

Only the study team can determine whether someone qualifies for participation.

Seizure group

Inclusion criteria

  • Aged between 6 and 12 years old
  • Newly diagnosed untreated epilepsy

Exclusion criteria

  • Treated with medicine or another therapy
  • Had history of cancer diseases
  • Had history of endocrine diseases

Healthy control group

Inclusion criteria

  • Aged between 6 and 12 years old

Exclusion criteria

  • Had history of epilepsy
  • Had history of cancer diseases
  • Had history of endocrine diseases

Treatment and study plan

SLC7A11, GPX4, P53

Genetic

Obtained patients or healthy controls peripheral blood , used Western blot and Rt-qPCR to investigate the possible difference between two groups

Primary outcomes

  1. Rt-qPCR

    Time frame: Participants' blood samples were collected when enrolled in this study, and the results of different relative mRNA expression (GPX4, SLC7A11, P53) on two groups would be reported through study completion, an average of 1 year.

    Rt-qPCR allows the investigation of gene expression changes; investigators used primers as follow:

    GPX4 Forward: GAGGCAAGACCGAAGTAAACTAC GPX4 Reverse: CCGAACTGGTTACACGGGAA P53 Forward: AACTGCGGGACGAGACAGA P53 Reverse: AGCTTCAAGAGCGACAAGTTTT SLC7A11 Forward: TCTCCAAAGGAGGTTACCTGC SLC7A11 Reverse: AGACTCCCCTCAGTAAAGTGAC

Secondary outcomes

  1. Western blot

    Time frame: Participants' blood samples were collected when enrolled in this study, and the results of different relative protein expressions (GPX4, SLC7A11, TP53) on two groups would be reported through study completion, an average of 1 year.

    Western blotting is an important technique used in cell and molecular biology. Using a western blot, investigators could investigate the possible protein differences of three GPX4 dependent ferroptosis pathway biomarkers: GPX4, SLC7A11, P53.

Sponsors and collaborators

Lead sponsor

Affiliated Hospital of Jiangnan University

Other

Registry information

Official study title

Association Between GPX4 Dependent Ferroptosis Pathway and Epilepsy in School-aged Children

Important dates

Study start
2021
Primary completion
2021
Study completion
2022
First posted
Mar 8, 2022
Registry last updated
Apr 15, 2022

OpenTrials presents study information sourced from ClinicalTrials.gov. The official registry record should be consulted for the latest information.

View the official ClinicalTrials.gov record (opens in a new tab)

This listing is for discovery and informational purposes only. It is not medical advice, does not guarantee that a study is recruiting, and does not determine eligibility. Contact the study team and a qualified healthcare professional when considering participation.

Related clinical trials

Published trials that share one or more normalized conditions with this study.